The histone H2A deubiquitinase USP16 interacts with HERC2 and fine-tunes cellular response to DNA damage. eukaryotic cells have developed a sophisticated molecular machinery, called the DNA damage response (DDR), to detect, signal?and repair the DNA lesions (1,3,5,6). The DDR executes a variety of responses such as cell-cycle checkpoint activation, DNA repair, apoptosis and senescence (5C8). In cells, DNA double-strand breaks (DSBs) have been considered to be the most cytotoxic type of DNA damage. They are responsible for the development of chromosomal aberrations or mutations and contribute to the development of diseases such as cancer because of inappropriate or deficient repair of DSBs (9C11). Therefore, defects or dysfunction in the DDR leads to genomic instability and tumorigenesis. However, DDR defects also confer increased sensitivity to DNA-damaging cancer therapy (10,12,13). RecQ Xanthopterin helicases are a highly conserved family of DNA processing enzymes. There are five RecQ helicases including RecQ1, BLM, WRN, RecQ4 and RecQ5 in humans (14). These members are involved in DNA metabolism, genetic stability and the DNA damage response, and play critical roles in the maintenance of genome stability (15C18). The mutation or loss of three genes BLM, WRN or RecQ4 leads to related diseases, which are Bloom syndrome (BS), Werner syndrome (WS) or Rothmund-Thomson syndrome (RTS), respectively (19C21). Patients with these diseases have profound developmental abnormalities and an increased susceptibility to cancer (22,23). BS patients are prone to develop multiple malignancies including breast, prostate and lung cancers (24). The defective protein in BS, BLM, is an upstream sensor protein in the DNA damage signaling cascade (25), plays important roles in the regulation of key DNA metabolism processes like DNA replication, recombination and repair (15). Increasing evidence suggests that BLM is involved in DSB repair; in accordance with this, the loss function of BLM in cancer cells causes hypersensitivity to DNA-damaging agents that directly or indirectly generate DSBs (26C29). BLM has been shown to be ubiquitinated, which in turn induces defect in DDR pathway (30,31). However, the deubiquitination process which Xanthopterin regulates BLM in the DDR is still not clear. In this study, we found that ubiquitin specific peptidase 37 Xanthopterin (USP37) functions as the deubiquitinase of BLM and regulates the DDR. Mechanistically, USP37 is phosphorylated by ATM following DNA damage, which increases the binding Xanthopterin between USP37 and BLM and leads to BLM deubiquitylation. Knockdown of USP37 impairs the DDR through BLM and results in increased sensitivity to cisplatin or IR treatment in breast cancer cells. In addition, we found that USP37 expression is up-regulated in breast cancer tissue arrays. In addition, GEO database showed that high expression of USP37 is significantly correlated with poor survival in breast cancer patients. Furthermore, USP37 knockdown sensitizes cancer cells to DNA-damaging agents in xenograft models, suggesting that the USP37CBLM axis may provide new therapeutic targets for overcoming chemo or radiotherapy resistance in breast cancer. MATERIALS AND METHODS Cell culture, plasmids and antibodies HEK293T, GP293, U-2OS, BT-549, T47D, MDA-MB-436, MDA-MB-468, MDA-MB-231, MCF7, Rabbit Polyclonal to MAP2K1 (phospho-Thr386) Hela, ER-AsiSI U2OS and MCF10A cell lines were cultured in DMEM, RPMI-1640, McCoy’s 5A or Ham’s F-12 supplemented with 10% FBS, 100 U of penicillin, and 100 g/ml streptomycin. These cells were originally from ATCC. Wild-type HA-FLAG-USP37 plasmid was purchased from Addgene (plasmid #22602), generated by Dr?Wade Harper from Harvard University. HA-FLAG-USP37 and MYC-BLM were subcloned into 3*FLAG-Plvx3 vector. All site mutants were constructed using the site-directed mutagenesis Kit (Stratagene) and verifified by DNA sequencing. MYC-tagged BLM was a gift from Junjie Chen in the University of Texas MD Anderson Cancer Center. The sequences of shRNAs from Sigma are listed below: USP37 shRNA#1: CCGGATTTGCAGAAGATGATA, USP37 shRNA#2: CCCTAACTTCTCTGGCCTATT, BLM shRNA: GCCTTTATTCAATACCCATTT. RAP80 shRNA: TGAGAAGGAAGTAGCTATTTC. The siRNAs.