Then, the cells were washed with PBS and total ribonucleic acid (RNA) was extracted using an RNA extraction kit (TransGen?Biotech, Beijing, China). (c) The concentration of IgE in BALF was measured by ELISA. Data are shown as the mean??SD (n?=?6). *for 10?min. Differential cell counts were performed and stained with Diff-Quik (Solarbio, Beijing). The cytokines in the supernatant were detected and the cell precipitation was resuspended. The type and quantity of leukocytes were calculated by a cell counter. The levels of IL-4, IL-5, IL-13, IFN-, TNF- and IgE were determined by ELISA packages (Nanjing Jiancheng Bioengineering Institute, China). Evaluation of lung oxidative stress Samples of lung tissues was cut up and homogenized with RIPA chilly lysis buffer for 3?min. After centrifugation (12,000to retain the supernatant. The 25 L of 15-fold diluted supernatant was utilized for protein GRI 977143 quantification. The loading buffer was added, and the remaining supernatant was separated by SDS-PAGE, and then transferred to PVDF membrane. The blots were cut prior to hybridisation with antibodies during blotting. Then sealed at room heat for 2?h and incubated with the primary antibodies (1:1000) overnight at 4?C. On the second day, the second antibody (1:15,000) was applied for 1?h, and the ECL kit was utilized for photodetection. The primary antibodies including anti-HO-1 Abs, anti-NF-B Abs, anti-Nrf2 Abs and anti-phosphorylated NF-B(p-NF-B) Abs that were used in the study were purchased from Proteintech Technology Inc. Cell culture and cytotoxic effects of 18-GA NCI-H292 cells were incubated in RPMI 1640 media (Procell, Wuhan, China) with 10% FBS (Biological Industries) and 1% antibiotics at 37?C in a 5% CO2 incubator. The cells were seeded in 96-well plates at a density of 5??104 cells/well and incubated in RPMI1640 in the presence of different concentrations of 18-GA (0, 2, 5, 10, 20, 40,80 and 160?M). The cytotoxic effect of 18-GA was evaluated by assessing cell numbers using a cell counting kit (CCK8 assay)36. Measurement of levels of pro-inflammatory cytokine production and ROS, and oxidative stress marker in cell NCI-H292 cells (5??104 cells/well) were seeded in 6-well plates in RPMI media, treated with 18-GA (0, 5, 10, and 20?M) and DEX(1?M) for 2 h37, and then incubated in the presence of human recombinant TNF- (20?ng/mL) for 24?h. The concentrations of TNF- and IL-6 in the GRI 977143 culture medium were quantified by ELISA kit (Nanjing Jiancheng Bioengineering Institute, China). The cells were collected and used to analyze ROS production, GSH and SOD, according to manufacturers instruction as explained above. Quantitative real-time polymerase chain reaction (PCR) analysis The cells were treated with 18-GA (0, 5, 10, and 20?M) and DEX (1?M) followed by TNF-(20?h). Then, the cells were washed with PBS and total ribonucleic acid (RNA) was extracted using an RNA extraction kit (TransGen?Biotech, Beijing, China). Real-time PCR was performed in triplicate with the CFX96 Touch? Real-time PCR detection system (Bio-Rad Laboratories). All primers were synthesized by TSINGKE(Wuhan, China). The sequences of all primers are outlined in Table ?Table11. Table 1 Sequences of primers for real-time quantitative. thead th align=”left” rowspan=”1″ colspan=”1″ Gene /th th align=”left” rowspan=”1″ colspan=”1″ Forword primer(5??3) /th th align=”left” rowspan=”1″ colspan=”1″ Reverse primer(5??3) /th /thead GAPDHCAGGAGGCATTGCTGATGATGAAGGCTGGGGCTCATTTIL-4ATGGGTCTCACCTCCCAACTTATCGCACTTGTGTCCGTGGIL-5CAGGGAATAGGCACACTGGATCTCCGTCTTTCTCCACACIL-13TGGTATGGAGCATCAACCTGACGCATCCTCTGGGTCTCG Open in a separate window Statistical analysis Data are expressed as mean??standard deviation (SD). The analysis used one-way ANOVA with Tukey post hoc test. Graphs are generated using Graphpad GRI 977143 prism 8. The statistically significances were set as the following: em p /em ? ?0.05, em p /em ? ?0.01 and em p /em ? ?0.001. A em KPSH1 antibody p /em -value 0.05 was considered to be statistically significant (Supplementary Information). Supplementary Information Supplementary Information 1.(3.3M, pdf) Supplementary Information 2.(6.9M, pdf) Acknowledgements This work was supported by funding from the Department.